BCMB 515

 

VECTOR SEQUENCES




In this section, we have established links to information about the two vectors that we will be using in the course. For pUC18, we have links to plasmid DNA maps, lists of restriction enzyme sites and the full DNA sequence. Click on the appropriate title to get the information you want!
 

A.  pUC18

pUC18 Map

RESTRICTION SITES

SEQUENCE

B.  pCR2.1 (Invitrogen)

pCR2.1 Map

RESTRICTION SITES

SEQUENCE

C.  Data for 515 Groups

Group 1  Group 3 Group 5
Group 2 Group 4 Group 6

                   



 

pUC18 DNA: Location of Restriction Endonuclease Sites

In this section are listed all enzymes that cut pUC18 one or two times. Also listed are enzymes which do not cut the vector. Other restriction sites should be assumed to occur greater than two times within the plasmid.

AatII 1 2617  
Acc65I/KpnI 1 435  
AccI 1 414  
AhdU/Eam1105I 1 1694  
AflIII 1 806  
AlwNI 1 1217  
ApoI 1 396  
AvaI 1 431  
BamHI 1 426  
BanII 1 402  
BcgI 1 2215  
BpmI 1 1784  
BsaI 1 1766  
BspMI 1 410  
BsfI 1 1779  
Ecl136II/SacI 1 441  
EcoO109I 1 2674  
EcoRI 1 447  
HincII 1 414  
HindIII 1 396  
KasI/NarI 1 235  
Nde 1 183  
PstI 1 407  
SalI 1 414  
SapI 1 683  
ScaI 1 2177  
SmaI/XmaI 1 431  
SphI 1 402  
Sse8387I 1 409  
SspI 1 2501  
SbaI 1 420  
XmnI 1 2294
BglI 2 245 1813
BsmBI 2 51 2683
BsrDI 2 1753 1935
DrdI 2 908 908
Eco57I 2 1333 2381
FspI 2 256 1919
Psp1406I 2 1924 2297
PvuI 2 276 2066
PvuII 2 306 628
TfiI 2 641 781

The following enzymes do not cut pUC18 DNA:

AflII, AgeI, ApaI/Bsp120I, AscI, AvrII, BbsI, BclI, BglII, BlpI, BsaAI,
BsaBI, BsseRI, BsgI, BsiWI, BsmFI, BsmI, BspDI/ClaI, BspEI, BstGI, BssHII,
Bst1107I, BstBI, BstEII, BstXI, Bsu36I, DraIII, DsaI, EagI, Eco47III, EcoNI, EcoRV, FseI, HpaI, MfeI, MluI, MscI, NaeI/NgoMI, NcoI, NheI, NotI, NruI, NsiI/Pps10I, PacI, PaeR7I/XhoI, PflMI, PmeI, PmlI, PpuMI, PshAI, RsrII, SacII, SexAI, SfiL, SgfI, SgrAI, SnaBI, SpeI, SrfI, StuI, StyI, SwaI, Tth111I, XcmI

 

pUC18 Sequence

 

DEFINITION pUC18 cloning vector.
ACCESSION L08752
KEYWORDS .
SOURCE Synthetic construct DNA.
ORGANISM Synthetic construct
Artificial sequences.
REFERENCE 1 (sites)
AUTHORS Norrander,J.M., Kempe,T. and Messing,J.
JOURNAL Gene 26, 101-106 (1983)
MEDLINE 84159483
REFERENCE 2 (bases 1 to 2686)
AUTHORS Gilbert,W.
TITLE Obtained from VecBase 3.0
JOURNAL Unpublished (1991)
COMMENT These data and their annotation were supplied to GenBank by Will
Gilbert under the auspices of the GenBank Currator Program. pUC18 -
Cloning vector
ENTRY PUC18 #TYPE DNA CIRCULAR
TITLE pUC18 - Cloning vector
DATE 17-SEP-1986
#sequence 16-DEC-1986
ACCESSION VB0025
SOURCE artificial
COLLECTION ATCC 37253
REFERENCE
#number 1
#authors Norrander J., Kempe T., Messing J.
#journal Gene (1983) 26: 101-106
REFERENCE
#number 2
#authors Pouwels P.H., Enger-Valk B.E., Brammar W.J.
#book Cloning Vectors, Elsvier 1985 and supplements
#comment vector I-A-iv-20
COMMENT
Assembled from pUC19 and M13mp18 by F. Pfeiffer, MPI,
Martinsried
Revised 16-DEC-1986 by F. Pfeiffer:
2308/9 'AT' to 'TA' to match revised sequence of PBR322
The strand shown contains the beta-galactosidase mRNA sequence
including the multiple cloning site of M13mp18. KEYWORDS
CROSSREFERENCE
#complement
VecBase(3):pUC18c
#parent
VecBase(3):pUC12, VecBase(3):M13mp18, VecSource(3):bGal18
#brother
VecBase(3):pUC19
#offspring
VecBase(3):pGEM3, VecBase(3):pTZ18R,
VecBase(3):pIBI24, VecBase(3):pIBI30, VecBase(3):pSP18,
VecBase(3):pT7T318, VecBase(3):pT7T3A18
PARENT
Features of pUC18 (2686 bp)
residue source
1- 447 6002-6448 M13mp18
1- 229 1069-1297 Lac-Operon
230- 286 1- 57 polylinker of M13mp18
289- 447 1303-1461 Lac-Operon
448- 547 2351-2252 (c) pBR322
548- 684 2210-2074 (c) pBR322
685-2686 4355-2354 (c) pBR322
Conflict (cfl) and Mutations (mut):
pUC18 source
mut 1128 T C 3912 (c) pBR322
mut 1429 A G 3611 (c) pBR322
FEATURE
952-1740 1-789 Ap-R; b-lactamase
POLYLINKER EcoRI-SacI-KpnI-SmaI-BamHI-XbaI-SalI-PstI-SphI-HindIII
SELECTION
#resistance Ap
#indicator beta-galactosidase
SUMMARY pUC18 #length 2686 #checksum 5464.

NCBI gi: 209211
FEATURES Location/Qualifiers
source 1. .2686
/organism="Synthetic construct"
/sequenced_mol="DNA"
BASE COUNT 659 a 684 c 677 g 666 t
ORIGIN

Synpuc18v Length: 2686 April 20, 1995 11:40 Type: N Check: 5464 ..

1 GCGCCCAATA CGCAAACCGC CTCTCCCCGC GCGTTGGCCG ATTCATTAAT

51 GCAGCTGGCA CGACAGGTTT CCCGACTGGA AAGCGGGCAG TGAGCGCAAC

101 GCAATTAATG TGAGTTAGCT CACTCATTAG GCACCCCAGG CTTTACACTT

151 TATGCTTCCG GCTCGTATGT TGTGTGGAAT TGTGAGCGGA TAACAATTTC

201 ACACAGGAAA CAGCTATGAC CATGATTACG AATTCGAGCT CGGTACCCGG

251 GGATCCTCTA GAGTCGACCT GCAGGCATGC AAGCTTGGCA CTGGCCGTCG

301 TTTTACAACG TCGTGACTGG GAAAACCCTG GCGTTACCCA ACTTAATCGC

351 CTTGCAGCAC ATCCCCCTTT CGCCAGCTGG CGTAATAGCG AAGAGGCCCG

401 CACCGATCGC CCTTCCCAAC AGTTGCGCAG CCTGAATGGC GAATGGCGCC

451 TGATGCGGTA TTTTCTCCTT ACGCATCTGT GCGGTATTTC ACACCGCATA

501 TGGTGCACTC TCAGTACAAT CTGCTCTGAT GCCGCATAGT TAAGCCAGCC

551 CCGACACCCG CCAACACCCG CTGACGCGCC CTGACGGGCT TGTCTGCTCC

601 CGGCATCCGC TTACAGACAA GCTGTGACCG TCTCCGGGAG CTGCATGTGT

651 CAGAGGTTTT CACCGTCATC ACCGAAACGC GCGAGACGAA AGGGCCTCGT

701 GATACGCCTA TTTTTATAGG TTAATGTCAT GATAATAATG GTTTCTTAGA

751 CGTCAGGTGG CACTTTTCGG GGAAATGTGC GCGGAACCCC TATTTGTTTA

801 TTTTTCTAAA TACATTCAAA TATGTATCCG CTCATGAGAC AATAACCCTG

851 ATAAATGCTT CAATAATATT GAAAAAGGAA GAGTATGAGT ATTCAACATT

901 TCCGTGTCGC CCTTATTCCC TTTTTTGCGG CATTTTGCCT TCCTGTTTTT

951 GCTCACCCAG AAACGCTGGT GAAAGTAAAA GATGCTGAAG ATCAGTTGGG

1001 TGCACGAGTG GGTTACATCG AACTGGATCT CAACAGCGGT AAGATCCTTG

1051 AGAGTTTTCG CCCCGAAGAA CGTTTTCCAA TGATGAGCAC TTTTAAAGTT

1101 CTGCTATGTG GCGCGGTATT ATCCCGTATT GACGCCGGGC AAGAGCAACT

1151 CGGTCGCCGC ATACACTATT CTCAGAATGA CTTGGTTGAG TACTCACCAG

1201 TCACAGAAAA GCATCTTACG GATGGCATGA CAGTAAGAGA ATTATGCAGT

1251 GCTGCCATAA CCATGAGTGA TAACACTGCG GCCAACTTAC TTCTGACAAC

1301 GATCGGAGGA CCGAAGGAGC TAACCGCTTT TTTGCACAAC ATGGGGGATC

1351 ATGTAACTCG CCTTGATCGT TGGGAACCGG AGCTGAATGA AGCCATACCA

1401 AACGACGAGC GTGACACCAC GATGCCTGTA GCAATGGCAA CAACGTTGCG

1451 CAAACTATTA ACTGGCGAAC TACTTACTCT AGCTTCCCGG CAACAATTAA

1501 TAGACTGGAT GGAGGCGGAT AAAGTTGCAG GACCACTTCT GCGCTCGGCC

1551 CTTCCGGCTG GCTGGTTTAT TGCTGATAAA TCTGGAGCCG GTGAGCGTGG

1601 GTCTCGCGGT ATCATTGCAG CACTGGGGCC AGATGGTAAG CCCTCCCGTA

1651 TCGTAGTTAT CTACACGACG GGGAGTCAGG CAACTATGGA TGAACGAAAT

1701 AGACAGATCG CTGAGATAGG TGCCTCACTG ATTAAGCATT GGTAACTGTC

1751 AGACCAAGTT TACTCATATA TACTTTAGAT TGATTTAAAA CTTCATTTTT

1801 AATTTAAAAG GATCTAGGTG AAGATCCTTT TTGATAATCT CATGACCAAA

1851 ATCCCTTAAC GTGAGTTTTC GTTCCACTGA GCGTCAGACC CCGTAGAAAA

1901 GATCAAAGGA TCTTCTTGAG ATCCTTTTTT TCTGCGCGTA ATCTGCTGCT

1951 TGCAAACAAA AAAACCACCG CTACCAGCGG TGGTTTGTTT GCCGGATCAA

2001 GAGCTACCAA CTCTTTTTCC GAAGGTAACT GGCTTCAGCA GAGCGCAGAT

2051 ACCAAATACT GTCCTTCTAG TGTAGCCGTA GTTAGGCCAC CACTTCAAGA

2101 ACTCTGTAGC ACCGCCTACA TACCTCGCTC TGCTAATCCT GTTACCAGTG

2151 GCTGCTGCCA GTGGCGATAA GTCGTGTCTT ACCGGGTTGG ACTCAAGACG

2201 ATAGTTACCG GATAAGGCGC AGCGGTCGGG CTGAACGGGG GGTTCGTGCA

2251 CACAGCCCAG CTTGGAGCGA ACGACCTACA CCGAACTGAG ATACCTACAG

2301 CGTGAGCTAT GAGAAAGCGC CACGCTTCCC GAAGGGAGAA AGGCGGACAG

2351 GTATCCGGTA AGCGGCAGGG TCGGAACAGG AGAGCGCACG AGGGAGCTTC

2401 CAGGGGGAAA CGCCTGGTAT CTTTATAGTC CTGTCGGGTT TCGCCACCTC

2451 TGACTTGAGC GTCGATTTTT GTGATGCTCG TCAGGGGGGC GGAGCCTATG

2501 GAAAAACGCC AGCAACGCGG CCTTTTTACG GTTCCTGGCC TTTTGCTGGC

2551 CTTTTGCTCA CATGTTCTTT CCTGCGTTAT CCCCTGATTC TGTGGATAAC

2601 CGTATTACCG CCTTTGAGTG AGCTGATACC GCTCGCCGCA GCCGAACGAC

2651 CGAGCGCAGC GAGTCAGTGA GCGAGGAAGC GGAAGA

  pCR2.1 DATA (Invitrogen)

A. Sequence of Vector:

AGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTT
TCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAG
GCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAA
ACAGCTATGACCATGATTACGCCAAGCTTGGTACCGAGCTCGGATCCACTAGTAACGGCCGCCAGTGTGC
TGGAATTCGGCTTAAGCCGAATTCTGCAGATATCCATCACACTGGCGGCCGCTCGAGCATGCATCTAGAG
GGCCCAATTCGCCCTATAGTGAGTCGTATTACAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGA
AAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAA
GAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGGACGCGCCCTGTAGCG
GCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCC
CGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGG
GGGCTCCCTTTAGGGTTCCGATTTAGAGCTTTACGGCACCTCGACCGCAAAAAACTTGATTTGGGTGATG
GTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAA
TAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCGCGGTCTATTCTTTTGATTTATAAGGG
ATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAATTCAGGGCGCAAGGGCTGCTA
AAGGAACCGGAACACGTAGAAAGCCAGTCCGCAGAAACGGTGCTGACCCCGGATGAATGTCAGCTACTGG
GCTATCTGGACAAGGGAAAACGCAAGCGCAAAGAGAAAGCAGGTAGCTTGCAGTGGGCTTACATGGCGAT
AGCTAGACTGGGCGGTTTTATGGACAGCAAGCGAACCGGAATTGCCAGCTGGGGCGCCCTCTGGTAAGGT
TGGGAAGCCCTGCAAAGTAAACTGGATGGCTTTCTTGCCGCCAAGGATCTGATGGCGCAGGGGATCAAGA
TCTGATCAAGAGACAGGATGAGGATCGTTTCGCATGATTGAACAAGATGGATTGCACGCAGGTTCTCCGG
CCGCTTGGGTGGAGAGGCTATTCGGCTATGACTGGGCACAACAGACAATCGGCTGCTCTGATGCCGCCGT
GTTCCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGTGCCCTGAATGAA
CTGCAGGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGGGCGTTCCTTGCGCAGCTGTGCTCGACG
TTGTCACTGAAGCGGGAAGGGACTGGCTGCTATTGGGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCG
CCTTGCTCCTGCCGAGAAAGTATCCATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGGCT
ACCTGCCCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCGGATGGAAGCCGGTCTTG
TCGATCAGGATGATCTGGACGAAGAGCATCAGGGGCTCGCGCCAGCCGAACTGTTCGCCAGGCTCAAGGC
GCGCATGCCCGACGGCGAGGATCTCGTCGTGATCCATGGCGATGCCTGCTTGCCGAATATCATGGTGGAA
AATGGCCGCTTTTCTGGATTCAACGACTGTGGCCGGCTGGGTGTGGCGGACCGCTATCAGGACATAGCGT
TGGATACCCGTGATATTGCTGAAGAGCTTGGCGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTAT
CGCCGCTCCCGATTCGCAGCGCATCGCCTTCTATCGCCTTCTTGACGAGTTCTTCTGAATTGAAAAAGGA
AGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTT
TGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATC
GAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCA
CTTTTAAAGTTCTGCTATGTCATACACTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCG
GGCGCGGTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATG
ACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAA
CGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCG
TTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGAGTGACACCACGATGCCTGTAGCAATGCCA
ACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGA
TGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAA
ATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGT
ATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAG
GTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAA
ACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAA
CGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTT
TTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCA
AGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTA
GTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCC
TGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACC
GGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTAC
ACCGAACTGAGATACCTACAGCGTGAGCATTGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACA
GGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTA
TCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGG
CGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTC
ACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATAC
CGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAG

  Restriction Map of pCR2.1

General Description

        DNA pCR2.1

        Entire molecule length: 3906 bp

Enzyme

# of cuts

Positions

Acc65I

1

241

AciI

49

19 29 85(c) 188(c) 270 326(c) 330 497 559(c) 573(c) 576(c) 604 631 746 885(c) 1010 1133(c) 1229 1332 1395 1489(c) 1553(c) 1654(c) 1657(c) 1897 1937(c) 1942 1992(c) 2008 2034 2149(c) 2258(c) 2385(c) 2500(c) 2546 2737(c) 2828(c) 3190 3199(c) 3334 3444(c) 3565(c) 3584(c) 3711(c) 3739(c) 3830 3851 3858 3901(c)

AcsI

3

284 300 958

AcyI

3

1175 1423 2354

AflII

1

292

AflIII

2

993 3782

AluI

22

56 120 215 237 249 475 690 729 947 1044 1097 1123 1169 1529 1987 2541 2604 2704 3225 3482 3618 3844

Alw44I

2

2222 3468

AlwI

17

248(c) 261 1244 1261 1291 1602 1667(c) 1846(c) 1848 2255 2259(c) 2576 3039(c) 3040 3136(c) 3138 3224

AlwNI

2

1047 3373

AosI

3

525 1525 2671

ApaI

1

355

ApaLI

2

2222 3468

ApoI

3

284 300 958

AseI

3

48 107 2719

AsnI

3

48 107 2719

Asp700

1

2294

Asp718

1

241

AspEI

1

2894

AspHI

6

251 1536 1726 2226 2311 3472

AspI

1

1541

AvaI

1

333

AvaII

3

1939 2530 2752

AviII

3

525 1525 2671

BamHI

1

253

BanI

7

132 241 736 1174 1422 1457 2941

BanII

4

251 355 706 1788

BbvI

19

65 465 538 607 962(c) 1370(c) 1496 1538 1554(c) 1647(c) 2059 2460(c) 2851 3154(c) 3360(c) 3363(c) 3453 3872 3890

BcgI

1

2356(c)

BclI

1

1264

BfaI

7

260 346 624 1124 2701 3036 3289

BfrI

1

292

BglI

2

535 2776

BglII

1

1259

BmyI

11

251 355 706 1369 1462 1536 1726 1788 2226 2311 3472

BpmI

1

2825

BsaAI

3

777 996 1727

BsaBI

3

314 1258 1282

BsaHI

3

1175 1423 2354

BsaI

1

2828

BsaJI

7

137 425 1028 1232 1586 1855 3622

BsaWI

6

987 1156 1454 2598 3429 3576

BsiEI

9

270 330 506 746 1332 2376 2525 3448 3872

BsiHKAI

6

251 1536 1726 2226 2311 3472

BsiYI

9

35 558 884 1404 1948 3304 3583 3749 3767

BslI

9

35 558 884 1404 1948 3304 3583 3749 3767

BsmAI

2

1265(c) 2828

BsmFI

2

558 1574

Bsp120I

1

351

Bsp1286I

11

251 355 706 1369 1462 1536 1726 1788 2226 2311 3472

BspHI

1

3062

BspMI

3

1081(c) 1310(c) 1691

BspWI

26

11 95 139 335 359 505 535 568 570 612 639 669 975 1114 1414 1498 1521 1660 1666 1783 1819 1866 2776 3164 3736 3850

BsrBI

5

188 332(c) 633(c) 2036(c) 3853(c)

BsrDI

3

1656 2660 2834(c)

BsrFI

4

672 1742 1923 2809

BsrI

20

82 273(c) 327 394 420 866 1005(c) 1052 1133 1217 1367 1568 2249 2419(c) 2688 2731 2849 3255 3367(c) 3380(c)

BssHII

1

1820

BstNI

6

139 427 1810 3623 3636 3757

BstUI

13

31 33 549 573 593 885 1489 1790 1822 2385 2828 3158 3739

BstXI

2

280 322

BstYI

11

253 1236 1259 1594 1840 2247 2264 3032 3044 3130 3141

CfoI

31

5 33 98 526 551 564 573 595 621 629 969 1079 1177 1248 1417 1425 1489 1526 1792 1822 1824 2052 2385 2672 2765 3158 3267 3441 3541 3608 3878

Cfr10I

4

672 1742 1923 2809

Csp6I

3

242 1728 2412

DdeI

4

2393 2933 3099 3508

DpnI

26

255 505 1238 1255 1261 1266 1285 1596 1674 1755 1764 1842 1853 2213 2249 2266 2524 2570 2588 2929 3034 3046 3124 3132 3143 3218

DpnII

26

253 503 1236 1253 1259 1264 1283 1594 1672 1753 1762 1840 1851 2211 2247 2264 2522 2568 2586 2927 3032 3044 3122 3130 3141 3216

DraI

3

2316 3008 3027

DraII

1

351

DraIII

1

780

DrdI

3

824 1450 3680

DsaI

1

1855

DsaV

13

137 425 1028 1425 1585 1808 2356 2378 2707 3403 3621 3634 3755

EaeI

9

37 267 327 391 1329 1503 1894 1921 2501

EagI

3

267 327 1329

Eam1105I

1

2894

EarI

5

484(c) 1767(c) 1977(c) 2095(c) 3899(c)

Ecl136II

1

249

EclXI

3

267 327 1329

Eco57I

4

1569 2001 2228 3240(c)

EcoO109I

1

351

EcoRI

2

284 300

EcoRII

6

137 425 1808 3621 3634 3755

EcoRV

1

312

Fnu4HI

38

54 270 327 330 454 527 560 574 596 976 1229 1332 1384 1395 1485 1490 1527 1568 1655 1658 1661 1897 1993 2034 2048 2150 2474 2501 2840 3168 3374 3377 3442 3585 3740 3858 3861 3879

FnuDII

13

31 33 549 573 593 885 1489 1790 1822 2385 2828 3158 3739

FokI

9

445(c) 1045 1228 1290 1747 1772 2455 2742 2923

FspI

3

525 1525 2671

HaeII

6

6 622 630 1178 1426 3542

HaeIII

19

39 269 329 353 393 495 785 927 1331 1505 1896 1923 2503 2770 2850 3308 3742 3760 3771

HgaI

4

555 2362 3092(c) 3670(c)

HgiAI

6

251 1536 1726 2226 2311 3472

HhaI

31

5 33 98 526 551 564 573 595 621 629 969 1079 1177 1248 1417 1425 1489 1526 1792 1822 1824 2052 2385 2672 2765 3158 3267 3441 3541 3608 3878

HinP1I

31

3 31 96 524 549 562 571 593 619 627 967 1077 1175 1246 1415 1423 1487 1524 1790 1820 1822 2050 2383 2670 2763 3156 3265 3439 3539 3606 3876

HindIII

1

235

HinfI

10

42 372 825 847 1908 2042 2895 3412 3808 3883

HpaII

23

160 673 988 1030 1157 1328 1405 1427 1455 1586 1676 1743 1924 2357 2379 2599 2709 2776 2810 3214 3404 3430 3577

HphI

6

777 2167(c) 2202 2408(c) 2824 3051

ItaI

38

54 270 327 330 454 527 560 574 596 976 1229 1332 1384 1395 1485 1490 1527 1568 1655 1658 1661 1897 1993 2034 2048 2150 2474 2501 2840 3168 3374 3377 3442 3585 3740 3858 3861 3879

KasI

2

1174 1422

KpnI

1

245

Ksp632I

5

484(c) 1767(c) 1977(c) 2095(c) 3899(c)

MaeI

7

260 346 624 1124 2701 3036 3289

MaeII

11

407 666 776 819 831 995 1539 1726 2292 2665 3081

MaeIII

14

262 411 431 587 599 1543 2233 2421 2574 2632 2963 3246 3362 3425

MamI

3

314 1258 1282

MboI

26

253 503 1236 1253 1259 1264 1283 1594 1672 1753 1762 1840 1851 2211 2247 2264 2522 2568 2586 2927 3032 3044 3122 3130 3141 3216

MboII

11

10 501 638(c) 1784 1994 2074(c) 2112 2221 2299 3054 3125(c)

McrI

9

270 330 506 746 1332 2376 2525 3448 3872

MluNI

1

1505

MnlI

18

32 342(c) 485(c) 750 1189 1274(c) 1338(c) 1474(c) 1831(c) 2024 2521(c) 2727(c) 2874 2955 3355 3605(c) 3679 3888(c)

MscI

1

1505

MseI

16

48 107 293 442 567 838 936 953 2315 2680 2719 2954 3007 3021 3026 3078

MslI

4

1860 2123 2482 2641

MspA1I

7

56 475 1169 1529 2258 3199 3444

MspI

23

160 673 988 1030 1157 1328 1405 1427 1455 1586 1676 1743 1924 2357 2379 2599 2709 2776 2810 3214 3404 3430 3577

MvaI

6

139 427 1810 3623 3636 3757

MvnI

13

31 33 549 573 593 885 1489 1790 1822 2385 2828 3158 3739

MwoI

26

11 95 139 335 359 505 535 568 570 612 639 669 975 1114 1414 1498 1521 1660 1666 1783 1819 1866 2776 3164 3736 3850

NaeI

2

674 1925

NarI

2

1175 1423

NciI

7

1030 1427 1587 2358 2380 2709 3405

NcoI

1

1855

NdeII

26

253 503 1236 1253 1259 1264 1283 1594 1672 1753 1762 1840 1851 2211 2247 2264 2522 2568 2586 2927 3032 3044 3122 3130 3141 3216

NgoMI

2

672 1923

NlaIII

14

226 342 1116 1297 1642 1828 1859 1885 2451 2487 2565 2575 3066 3786

NlaIV

17

134 243 255 353 705 717 738 986 1176 1424 1459 2597 2808 2849 2943 3715 3754

NotI

1

327

NsiI

1

344

NspI

3

342 1828 3786

PaeR7I

1

333

PleI

6

380 833 841(c) 2903 3406(c) 3891

Ppu10I

1

340

Psp1406I

2

2292 2665

PstI

2

309 1476

PvuI

2

506 2525

PvuII

4

56 475 1169 1529

RcaI

1

3062

RsaI

3

243 1729 2413

RsrII

1

1939

SacI

1

251

SapI

3

1767(c) 1977(c) 3899(c)

Sau3AI

26

253 503 1236 1253 1259 1264 1283 1594 1672 1753 1762 1840 1851 2211 2247 2264 2522 2568 2586 2927 3032 3044 3122 3130 3141 3216

Sau96I

9

351 352 494 783 1939 2530 2752 2769 2848

ScaI

1

2413

ScrFI

13

139 427 1030 1427 1587 1810 2358 2380 2709 3405 3623 3636 3757

SfaNI

11

351 1381(c) 1636(c) 1722 1786 1852(c) 2061 2193(c) 2442 2633(c) 3685(c)

SfcI

7

305 365 554 1472 2648 3326 3517

SnoI

2

2222 3468

SpeI

1

259

SphI

2

342 1828

StyI

2

1232 1855

TaqI

8

334 742 1536 1692 1716 1752 2240 3684

TfiI

4

42 1908 2042 3808

ThaI

13

31 33 549 573 593 885 1489 1790 1822 2385 2828 3158 3739

Tru9I

16

48 107 293 442 567 838 936 953 2315 2680 2719 2954 3007 3021 3026 3078

Tsp509I

13

104 179 196 284 300 356 383 958 1160 2088 2461 2716 3022

Tth111I

1

1541

XbaI

1

345

XcmI

1

1239

XhoI

1

333

XhoII

11

253 1236 1259 1594 1840 2247 2264 3032 3044 3130 3141

XmaIII

3

267 327 1329

XmnI

1

2294

 

        No cuts: AatI, AatII, AccI, AccIII, AgeI, AscI, AsuII, AvrII, BbrPI, BbsI, BlnI, Bpu1102I, BpuAI, BseAI, BsgI, BsiWI, BsmI, BspDI, BspEI, BsrGI, Bst1107I, BstBI, BstEII, Bsu36I, CelII, ClaI, Csp45I, Eco47III, EcoNI, Esp3I, EspI, HincII, HindII, HpaI, KspI, MfeI, MluI, MroI, MunI, NdeI, NheI, NruI, NspV, PacI, PflMI, PinAI, PmaCI, PmeI, PmlI, PpuMI, SacII, SalI, SexAI, SfiI, SfuI, SgrAI, SmaI, SnaBI, SspBI, SspI, StuI, SwaI, Van91I, XmaI

 

  Group 1

Sequence from GV-1 Oligo:

CGTTGTAAAACGACGGCCAGTGCCAAGNCTTGCATGCCTGCAGGTCGACTCTAGGAGGATCCCCGGGTACCGAGCTCGAA

TTCGCGCCCGGGGTATCCTCTAGCGCCATGGCACCCCTGAGACCCCTTCTCATACTGGCCCTGCTGGCATGGGTTGCTCT

GGCTGACCAAGAGTCATGCAAGGGCCGCTGCACTGAGGGCTTCAACGTGGACAAGAAGTGCCAGTGTGACGAGCTCTGCT

CTTACTACCAGAGCTGCTGCACAGACTATACGGCTGAGTGCAAGCCCCAAGTGACTCGCGGGGATGTGTTCACTATGCCG

GAGGATGAGTACACGGTCTATGACGATGGCGAGGAGAAAAACAATGCCACTGTCCATGAACAGGTGGGGGGCCCCTCCCT

GACCTCTGACCTCCAGGCCCAGTCCAAAGGGAATCCTGAGCAGACACCTGTTCTGAAACCTGAGGAAGAGGCCCCTGCNC

CTGANGTGGGCGCCTCTAANCCTGAGGGGATANACTCAAGGCCTGANACCCTTCATCCAAGGAGACCTCANNCCCCAGCA

NAAGANGAGCTGTGCAGNGGGAANCCCTTNGACGCCTTCACCGACCTNAAGAACGGTTCCCTCTTTNCCTTNCNAGGGCA

GNNCTGCTATNAACTGGAACNAAAANGCANNGAGGCCTGGGTACCNCAANCTCATNCCANANGNNTGGGGCNTCNANAGG

CCCCATNNANNCCCCCTTNACCCNCNNNAACTNTNAGNGGNAAGANCTANNTNTTCANGGTTNNNNNNNCTGNCCCNTTN

NANANNNNGNNCCNGNCCCNGATNCCCCNAANATNNNTNACNGNTNNANGNNNNCCCNNNAACGGNANCNGNNTNNGCNT

CCTNCCNNNNNANNNNNNCNNNANNGGNTNNTTTTTNAGNGGAANANNNNNGNNNCCCNNCCGNNCNNNC

 

Sequence from GV-2 Oligo

ACAGCTATGACATGATTACGAATTCCTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCGGGGCTAANGGACCNTTA

TTGGGCTGGGGGAANGAAANGGGAGGANGGACCNCCCAAGGGCCCCGCCATNTGGGCNCNNACTCCTACAAATGGCCANN

ACCTGGCCNCCCCANCCAATNCNNACCNATNNANCCTGGGTANGNANNNCCCNCAGNGNCCNCNCCCCNAGNGCCAANAN

GGACNCNANNGNCCTTNACNCCCCAAAAAAAAAAAACCCNCCNGCTNGNNTCACAGCTCACAACCCCANCCCNGCCCANC

CTGTGANCANNANAANTGCTCCCNCCCAANAAGCTCNCCCNNCNTNAAAACAANCACNGCCNCNTANANCCCNAAAACNC

GNCAAAANGTCNNGTTACGCNCNCANAAANAACNCCNGCNTAAACNGAAAACCGNCCACCACAANATNTCAAAACCTTNN

GTCCCTAACCCAAGCGCGCACCAGACCNCNAATCAAAAAAANAAANGCCCCGGCNANNCNGCCCAAACCNCTAACCCTNC

CNACCANTGCCNAACCNNCCAANCANAANGNNCCTNACAANACCCCNAANCNNCCACCCCCCNAAAACNNNCCNCCGAAA

CCCCCGCCCACGGCNCNCCAGCCTCCTNAAAAATANCACNNNCANNCCNNACNNCCNNGANACCGNNNCCCCNANNNNNA

AANACGCCCAAAANCANCCNCCCCCNAGNCACNCCNNNGCAANANCCACCNNCGCCNGCGANCAACNAAAANANANGNGG

CGNNGGCCCGGAGACCNGNACCCNACANCCCNAAANCNCANGCGNNCCCNNNANGNCCNNNANACACCCCNCGNCCCAAA

GNNNAGCNACNCNCNCCNNNNGNCANANANAGNNGCANANCAANCNCCCT

 

 

  Group 2

Sequence from GV-1 Oligo:

TAAAACGACGGCCGTGCCAAGCTTGGCTGCAGGTCGACGGATCCGTCCCGGATAAGACGCGACCGGCGTCGCATCCGGCG

CTAGCCGTAAATTCTATACAAAATTACCGCCGCTCCAGAATCTCAAAGCAATAGCTGTGAGAGTTCTGCGCATCAGCATC

GTGGAATTCTATTAGTTGATGCGTTCAAGCGCCGCAACAGGATAGATCTGTACTGAGCCCGGGTGAGCCTCAGACTCGAC

GGCGTAGCCCTCAGGGGTCAAATTTGTGCAGTACCACCCGACAATCTGACCTTGCCAGGCGGCGCCGGATTTCTTACGTA

CGCGGTCACCCATACCAAACGTGGCGTTCGATGGGAATACAAAATTGCCGGCAACTGGATTCGAAACTTCATTAGAGCTC

CTGATCATTGAGATTTCCCGATAAAAAAAATTGTCGCCACTATACGTAAAGCGTAAACCGTCGTCAACTGGTGCGAGGAT

GATGTTGAGGAAAATTTTATATTCTGCTGGCGAGTCCACGCTCTCTCCCTGGACTCGCCGCATTACAATGAAACAAAAAC

AAACAGTTAGCTGTAAAGTGTGATTTACGTCACTCTTTATTAGGATGAGGGTTTCGTTTCCGGTTCATCCGCCATGTTGN

CGGTATGTTTACCTTCTTCGGNTCCCTGCCAGCCATGTCGTTGAATNAATGACAGATGTTCGCGGGCCTCGGTAATGATC

TCACTTAACATCGCGCTGGTGCGTTTATANACCNCCGCGCGGGCTTTGGNGNCGNTNTCAANCATTGCCATTTCTTNCCC

CATTTGAATNTNAAAGGGGNGGAACACATTGGGNCGTTNTCGCGCTTTANCCGGNCCCAAACCTAAACTTTTCAAGGCCA

AACCCCNGGTTTTAACGCNCNTNCNAGGGTTNACCCNCC

 

Sequence from GV-2 Oligo

CAGCTATGACCTGATTACGAATTCCCGGGGATCCGTCGACCACTACATTCGTTTGCGTCAGGCAGGCGTTGAAAAGCCGG

AGCGTGAAACCTTCGAAGGTGCGCTGAAAACCGGGCGTCTGGCACTGGAAAGTTTAGGTCTGGGGCCGTATGAAGCGCGA

GAACGTGCCGATGTGTTCCGCCGCTTTAATATTCAGATGGTGGAAGAGATGGCAATGGTTGAGAACGACACCAAAGCCCG

CGCGGCGGTCTATAAACGCACCAGCGCGATGTTAAGTGAGATCATTACCGAGGACCGCGAACATCTGTCATTAATTCAAC

GACATGGCTGGCAGGGAACCGAAGAAGGTAAACATACCGGCAACATGGCGGATGAACCGGAAACGAAACCCTCATCCTAA

TAAAGAGTGACGTAAATCACACTTTACAGCTAACTGTTTGTTTTTGTTTCATTGTAATGCGGCGAGTCCAGGGAGAGAGC

GTGGACTCGCCAGCAGAATATAAAATTTTCCTCAACATCATCCTCGCACCAGTTGACGACGGTTTACGCTTTACGTATAG

TGGCGACAATTTTTTTTATCGGGAAATCTCAATGATCAGGAGCTCTNATGAAGTTTCGAATCCAGTTGCCGGCAATTTTT

GTATTCCCATCGAACGCCACGTTTGGNTATGGGTGACCGCGTACGTAAGAAATNCCGGCGCCCCCTGGCAAGGTCANATT

GTCNGGGGGTACTGCACAAATTTGACCCCTGAGGGCTACNCCCGNCGAGTNTGAGGNTCCCCCGGGNTNAANACAGATTT

ATTCTGTTGGNGGGNNTTGANCCCTNCAACTAATAGAATTNCCCGATGNTGGTGCGCANAACTCTCACAGNTNTTGNTTT

GNAANTNTNGGGCNGNCGGAATTTTGTNNAAAANTACCGGTAACGCCNGNTGCCNCC

 

 

 

  Group 3

Sequence from GV-1 Oligo:

GTTGTAAAACGACGGCCAGTGAATTGTAATACGACTCACTATAGGGCGAATTGGGCCCTCTAGATGCATGCTCGAGCGGC

CGCCAGTGTGATGGATATCTGCAGAATTCGGCTTGTCGACCCCATGGCAGAGGAGGAGCTGTGCAGTGGGAAGCCCTTCG

ACGCCTTCACCGACCTCAAGAACGGTTCCCTCTTTGCCTTCCGAGGGCAGTACTGCTATGAACTGGACGAAAAGGCAGTG

AGGCCTGGGTACCCCAAGCTCATCCGAGATGTCTGGGGCATCGAGGGCCCCATCGACGCCGCCTTCACCCGCATCAACTG

TCAGGGGAAGACCTACCTCTTCAAGGGTAGTCAGTACTGGCGCTTTGAGGATGGTGTCCTGGACCCTGATTACCCCCGAA

ATATCTCTGACGGCTTCGATGGCATCCCGGACAACGTGGATGCAGCCTTGGCCCTCCCTGCCCATAGCTACAGTGGCCGG

GAGCGGGTCTACTTCTTCAAGGGGAAACAGTACTGGGAGTACCAGTTCCAGCACCAGCCCANTCAGGAGGAGTGTGAAGG

CAGCTCCCTGTCGGCTGTGTTTGAACACTTTGCCATGATGCAGCGGGACAGCTGGGANGACATCTTCGAGCTTCTCTTCT

GGGGCAGAACCTCTGCTGGTACCAGACAGCCCCAGTTCATTANCCCGGGNACTGGCACNGTGTGCCAGGGCAAGTGGACT

GCGCNATGGCTTTAAAANCCGAATTCCACCACACTGGCGGNCGTTACTATTGGATCCNAGCTCGGNCCCANCTTGGCGAA

ACATGGGCATANCTGNTTCCTGTGNGAAAATGTNTTCCNTTCNAANTTCCCNNAAANNNNANCCGGAAACTAAAANGTAA

ANCCTGGGGNGCCTNNAGAGNGANCTNACTCCNTT

 

 

Sequence from GV-2 Oligo

AGCTATGACCTGATTACGCCAAGCTTGGTACCGAGCTCGGATCCACTAGTAACGGCCGCCAGTGTGCTGGAATTCGGCTT

TTAAGCCATTGCGCAGTCCACTTGCCCTGGCACACCGTGCCAGTCCCGGCTAATGAACTGGGGCTGTCTGGTACCAGCAG 

AGGTTCTGCCCCAGAAGAGAAGCTCGAAGATGTCCTCCCAGCTGTCCCGCTGCATCATGGCAAAGTGTTCAAACACAGCC

GACAGGGAGCTGCCTTCACACTCCTCCTGACTGGGCTGGTGCTGGAACTGGTACTCCCAGTACTGTTTCCCCTTGAANAA

GTAGACCCGCTCCCGGCCACTGTAGCTATGGGCAGGGAGGGCCAAGGCTGCATCCACGTTGTCCGGGATGCCATCGAAGC

CGTCAGAGATATTTCGGGGGTAATCAGGGTCCAGGACACCATCCTCAAAGCGCCAGTACTGACTACCCTTGAAGAGGTAG

GTCTTCCCCTGACAGTTGATGCGGGTGAAGGCGGCGTCGATGGGGCCCTCGATGCCCCAGACATCTCGGATGAGCTTGGG

GTACCCAGGCCTCACTGCCTTTTCGTCCAGTTCATAGCAGTACTGCCCTCGGAANGCAAAGAGGGAACCGTTCTTGANGT

CGGTGAANGCGTCAAAGGGCTTCCCACTGCACAGCTTCTTCTNTGCCATGGGGTCGACAAGCCGAATTCTGCAGATATNC

ATCACACTGGCGGNCGNTCGAGCATGCATTTAGAGGGNCCNATTCNCCCTATAGNGAGTCGTNTTACAATTCACTGGCCG

GCGTTTTACAACGTNNGNGACTGGGAAAACCCTGGNGTTNCCNANNTNATTGCCTTGGAAAAATNCCCCTTTTNCCAGCT

GGGGTATAACNAAAANGNCCCCNCNATCNCCNTTTCCANANTTGCCCACCTTANGGGAAANNNCCCCCCNTTANCGG

 

 

  Group 4

Sequence from GV-1 Oligo:

sequencing failed...

 

Sequence from GV-2 Oligo

CAGATTCTGGCTGATCAGCTGACTGACGAGCAGATCGCTGAATTTAAAGAGGCTTTCTCTCTGTTTGACAAAGACGGTGA

CGGTACCATCACTACCAAAGAGCTCGGCACCGTTATGCGCAGCCTTGGCCAGAACCCGACTGAAGCTGAACTGCAGGACA

TGATTAACGAAGTCGACGCTGACGGTAACGGCACCATCGATTTTCCGGAATTTCTGAACCTGATGGCGCGCAAGATGAAA

GACACTGACTCTGAAGAGGAACTGAAAGAGGCCTTCCGTGTTTTCGACAAAGACGGTAACGGTTTCATCTCGGCCGCTGA

ACTGCGTCACGTTATGACTAACCTGGGTGAAAAGCTTACTGACGAANAAGTTGACGAAATGATTCGCGAAGCTGACGTCG

ATGGTGACGGCCAGGTTAACTACNAAGAGTTCGTTCAGGTTATGATGGCTAAGTAGGATCCTGGCGTAATAGCGAAGAGG

CCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGCGCCTGATGCGGTATTTTCTCCTTACGCAT

CTGTGCGGTATTTCACACCGCATATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGCCCCGACA

CCCGNCAACACCCGNTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCTNCG

GGAGCTGCATGTGTCAAANGGTTTCACCCGTCATCACCGAAACGCGCGAAACAAAAGGGCCTCGGGANNCNCCTNTTTTT

TAGGGTAATGGCATGATAAAANGGGNTTTTAAACCCCAGGGGGNNNTTTTNGGGNAANGTGCNNGGANCCCNTTTTGNTT

TTTTTNTAAAACNTNNAAANTGTTNCNCTCAGNAAAAANACCCTGNNAATGCTTNATAN

 

 

  Group 5

Sequence from GV-1 Oligo:

TTGTAAAACGACGGCCAGTGAATTGTAATACGACTCACTATAGGGCGAATTGGGCCCTCTAGATGCATGCTCGAGCGGCC

GCCAGTGTGATGGATATCTGCAGAATTCGGCTTGTCGACCCCATGGCAGAGGAGGAGCTGTGCAGTGGGAAGCCCTTCGA

CGCCTTCACCGACCTCAAGAACGGTTCCCTCTTTGCCTTCCGAGGGCAGTACTGCTATGAACTGGACGAAAAGGCAGTGA

GGCCTGGGTACCCCAAGCTCATCCGAGATGTCTGGGGCATCGAGGGCCCCATCGATGCCGCCTTCACCCGCATCAACTGT 

CAGGGGAAGACCTACCTCTTCAAGGGTAGTCAGTACTGGCGCTTTGAGGATGGTGTCCTGGACCCTGATTACCCCCGAAA

TATCTCTGACGGCTTCGATGGCATCCCGGACAACGTGGATGCAGCCTTGGCCCTCCCTGCCCATAGCTACAGTGGCCGGG

AGCGGGTCTACTTCTTCAAGGGGAAACAGTACTGGGAGTACCAGTTCCAGCACCAGCCCANTCAGGAGGAGTGTGAAGGC

AGCTCCCTGTCGGCTGTGTTTGAACACTTTGCCATGATGCANCGGGACAGCTGGGANGACATCTTCGAGCTTCTCTTCTG

GGGCAGAACCTCTGCTGGTACCAGACAGCCCCAGTTCATTANCCGGGACTGGCACNGTGTGCCAGGGCAAGTGGACNCAA

CCATGGGTNGGCCNCATNTACATNTNANGGGTNGGNCCCCCCCCCNTNCTTGGNCNAAAAAAAAAAGGNTTTAGGGATTN

NAANCCNCAAAGGGTNNCCNTTNNAANAAAGGNCNCANNCGGGGGGCGNAAACAAAAATTCCGNCNGGNCTTCCCCNNCC

ANGNGGGTGNTCNTTTTTTTCCAAGGNNGNNNAANANNTTNGGGANCCCAN

 

Sequence from GV-2 Oligo

AGCTATGACCTGATTACGCCAAGCTTGGTACCGAGCTCGGATCCACTAGTAACGGCCGCCAGTGTGCTGGAATTCGGCTT

GGCTCTGACTCCTACAGATGGCCAGGAGCTGGGCAGCCCAGCCAGTACTGAGCGATGGAGCGTGGGTAGGGAGGGTCCAC

AGTGTCCACTCGCCGTGTGCGAAGATTGACTCGGTAGTACTTGTCTCCAGAGAAGAAGAAGACACTCTGGATGGGTTCAC

AGGTGGCAGGCACAAGCCAGTCCATCCTGTAGTCATCATAGTTGTTGGCTCCCAAGTTGCTCTCCTCACTGGAGAACAAG

GACAGCCACGTGGCGCGGGATGGCCGGCGGGAGTTCTGGTTGCGGCCACGGCTGTGGCCTCGTTGTGAACGGTAGCCTTT

GCGGTTGCGATGCCTAAACCTTTGTTTCTTGGCCAAGGAGGGGCGGGGTGCCATGCCTGAGATGTAGATGCGGCCAGCCA

TGGCTGCGTCCACTTGCCCTGGCACACCGTGCCAGTCCCGGCTAATGAACTGGGGCTGTCTGGTACCAGCAGAGGTTCTG

CCCCAGAAGAGAAGCTCGAAGATGTCCTCCCAGCTGTCCCGCTGCATCATGGCAAAGTGTTCAAACACAGCCGACAGGGA

GCTGCCTTCACACTCCTNCTGACTGGGCTGGTGCTGGAACTGGTACTCCCANTACTGTTTCCCCTTNAAAAATANACCCN

CTCCCCGCCACTGTANCTNTGGGCAGGGAGGGCCANGNTNCNTCCCCTTGTCCGGGATGCCTTNNAACCCCCANANATTT

TTCGGGGGNATNAGGGNCCAAAAANCATTCTTAAANGCCNGTACTGACTNCCTTTNAAANGGNGGTNTNCCCTCANNNTT

NTGCNGGNGAAGCGGGNTTTNTGGGGCCCTTATNCCCNNAATTTTGGAAANNTTGGGGNCCCNC

 

 

  Group 6

Sequence from GV-1 Oligo:

GTTGTAAAACGACGGCCAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGCAGGATCCCCGGGTACCCGGCTCGAATT

CTCATGTTTGACAGCTTATCATCGATAAGCTTGGGGTAACGCAATCAGTATTGTTCATTTTTTTTCCCGGAAAAGCTAAG

AGTTTTCTGGCGAGATAAGATAACGGCGCCGAAGGCAGCGGCGAACTGACTTACCTCCGTCGGCTCCGGCGTACGGCACC

AAAAAATCCCGCAATAACTTGACACCAATGGGCTAACGGCGTCCGCAGAACCGTGACGCAATCTGCGGTTTGTGTCAAGA

CAGAGAAGTGGGCTGCTTCTCCCCTTTCAACACTCCCCTCCCATGGCTGAATACTCAGACGTTTTCTGTGGTGGAAATGG

CATCAAAAGTGCCACTGGCTGGCGAATCCAGACTATTTTGTGTCAAANAAACATGCGTACCTGCACAATAAAAAGAAAAG

GCCCGCCCTACTGACATCCTGTTCAGGATCCTCGAAGAACAGGAAAAAGGACAACCGTCCTTTTCACTTCACGTTCGCAG

GGCTTTCCTCGATATAATGGCGATTACACAAGCGGTGGCGTCTTGAAAAAAGTTGGGTTTCTTATCTGTACNGCGATCAC

TCCCCTCATATGATAGCTGTGTACAGTGACTTGCTCTTTGATTGGCCTTACTTCTTGCATCTATCATNCCTTTCTTTTAC

TCTNTCCATCACCACAACTNATATCATTCTACNTTTCATNTTATTGGTCTGNNCAATNTTTAGGGTGNAAAAAATATAAG

GGNNGTCNTATTTTCTNNTNCTTTCCGNTGGGGCNNTTTTAGGGGTGGCTTATTACCATTTTCCTACTTATTTTTACTGC

NTTANTTNAAAAAAGGNTNCCCNNNGCTGTTCCCTGAAAAAT

 

 

Sequence from GV-2 Oligo

CAGCTATGACATGATTACGAATTCCATGTAATTCCATCATACTGGCCTGNGTGATGAAACTGGAAATCATGGTACCGTAT

TGGGTCCAATAAATTGGGTAGAATATAAAGACTTTACAAGCCGCCAAAGCTCTCTTAATTTCATCAACAAATTTGTCATT

CCATGGATAGTTCTTTTCTGGATGAACAGAAGGTTTAGCAGCGTTGAAGTCGAACTTATTCTTAGTTAAAATCCAACAAA

CTTTAAAACTTTTAGCGATGACTTTATCTCCGATTGGTCTTTGAATGTATTGCTTTTTACCAAAAATCAAAGTGACAACA

GCGATCCAAAAGAAGCAGAAGGGCAATAGATAGGCCGCCCAGAACCCCTTATGATATTCCAATTCAGTAGTGGCCATTAA

TGATAGAGAACCGACATTAATCATGAAATAGGCGAACATAAAAACGTTTTGTAAAGTAATATTTGAATCGACAATGACTC

TTTCGCCCGATTTTAAAACTTTGATGGAGGGTTTCCGCTTAGGAAGCTGGTCGGCAATCAACACGGAAAGGTTANCTTTA

ATCATACCAGTGGCAATACCGATCAGAATAATGGCAGCAATGAACCCACCAATAGCACTGTCTCTGTTACCAACGGAGGG

NATCGAAGTGATAAATAGAATGAAANTNCCGGCAATGTAAATAGGCGGTNCCGCCANCAAATTGTNTTATATTTACCCNA

NANGGTGTCCCCCACGNNACCNCCNAAAACTGGTNGTNACCNTACACCAAAACTGGAAAAAATACGACACCCCANTGGGC

CCCCTGNACNGNTNAAGNNCAAAACACCCTTTGGGGAGNAATNAGGNCCNTTTNCATNTANNTTTGGNAAGGGGGCGAAA

ANCCCCNANTAGGANAANTNNNGGGAAGCTTNCCATANCAATNACCNNCCCTCNTAGGAANTTTNCNCCC